DNA Fingerprinting

views updated May 23 2018

DNA Fingerprinting

The mechanics of genetic fingerprinting

Genetic fingerprinting as a forensic tool

Historical uses of genetic fingerprinting

Resources

Genetic, genomic, or DNA fingerprinting is the term applied to a range of techniques that are used to show similarities and dissimilarities between the DNA present in different individuals.

Genetic fingerprinting is an important tool in the arsenal of forensic investigators. Genetic fingerprinting allows for positive identification, not only of body remains, but also of suspects in custody. Genetic fingerprinting can also link suspects to physical evidence.

Sir Alec Jeffreys at the University of Leicester developed DNA fingerprinting in the mid 1980s. The sequence of nucleotides in DNA is similar to a fingerprint, in that it is unique to each person. DNA fingerprinting is used for identifying people, studying populations, and forensic investigations.

The mechanics of genetic fingerprinting

The nucleus of every cell in the human body contains deoxyribonucleic acid (DNA), a biochemical molecule that is made up of nearly three-billion building blocks called nucleotides. DNA consists of four different nucleotides, adenine (A), thymine (T), guanine (G), and cytosine (C), which are linked together in a sequence that is unique to every individual. The sequence of A, T, G, and C in human DNA can be found in more combinations or variations than there are humans. The technology of DNA fingerprinting is based on the assumption that no two people have the same DNA sequence.

The DNA from a small sample of human tissue can be extracted using biochemical techniques. Then the DNA can be digested using a series of enzymes known as restriction enzymes, or restriction endonucleases. These molecules can be thought of as chemical scissors, which cut the DNA into pieces. Different endonucleases cut DNA at different parts of the nucleotide sequence. For example, the endonuclease called SmaI cuts the sequence of nucleotides CCCGGG between the third cytosine (C) and the first guanine (G).

After being exposed to a group of different restriction enzymes, the digested DNA undergoes gel electrophoresis. In this biochemical analysis technique, test samples of digested DNA are placed in individual lanes on a sheet of an agarose gel that is made from seaweed. A separate lane contains control samples of DNA of known lengths. The loaded gel is then placed in a liquid bath and an electric current is passed through the system. The various fragments of DNA are of different sizes and different electrical charges. The pieces move according to their size and charge with the smaller and more polar ones traveling faster. As a result, the fragments migrate down the gel at different rates.

After a given amount of time, the electrical current in the gel electrophoresis instrumentation is shut off. The gel is removed from the bath and the DNA is blotted onto a piece of nitrocellulose paper. The DNA is then visualized by the application of radioactive probe that can be picked up on a piece of x-ray film. The result is a film that contains a series of lines showing where the fragments of DNA have migrated. Fragments of the same size in different lanes indicate the DNA has been broken into segments of the same size. This demonstrates a similarity between the sequences under test.

Different enzymes produce different banding patterns and normally several different endonucleases are used in conjunction to produce a high definition banding pattern on the gel. The greater the number of enzymes used in the digestion, the finer the resultant resolution.

In genetic or DNA fingerprinting, scientists focus on segments of DNA in which nucleotide sequences vary a great deal from one individual to another. For example, 5–10% of the DNA molecule contains regions that repeat the same nucleotide sequence many times, although the number of repeats varies from person to person. Jeffreys targeted these long repeats called variable number of tandem repeats (VNTRs) when he first developed DNA fingerprinting. The DNA of each person also has different restriction fragment sizes, called restriction fragment length polymorphisms (RFLPs), which can be used as markers of differences in DNA sequences between people. Today, technicians also use short tandem repeats (STRs) for DNA fingerprinting. STRs are analyzed using polymerase chain reaction or PCR, a technique for mass-producing sequences of DNA. PCR allows scientists to work with degraded DNA.

Genetic fingerprinting as a forensic tool

Genetic fingerprinting is now an important tool in the arsenal of forensic chemists. It is used in forensics to examine DNA samples taken from a crime scene and compare them to those of a suspect. Criminals almost always leave evidence of their identity that contains DNA at the crime scene—hair, blood, semen, or saliva. These materials can be carefully collected from the crime scene and fingerprinted

Although DNA fingerprinting is scientifically sound, the use of DNA fingerprinting in courtrooms remains controversial. There are several objections to its use. Lawyers who misrepresent the results of DNA fingerprints may confuse jurors. DNA fingerprinting relies on the probability that individuals will not produce the same banding pattern on a gel after their DNA has been fingerprinted. Establishing this probability relies on population statistics. Each digested fragment of DNA is given a probability value. The value is determined by a formula relating the combination of sequences occurring in the population. There is concern that not enough is known about the distribution of banding patterns of DNA in the population to express this formula correctly. Concerns also exist regarding the data collection and laboratory procedure associated with DNA fingerprinting procedures. For example, it is possible that cells from a laboratory technician could be inadvertently amplified and run on the gel. However, because each person has a unique DNA sequence and this sequence cannot be altered by surgery or physical manipulation, DNA fingerprinting is an important tool for solving criminal cases.

A famous example from the 1990s concerns O.J. Simpson. Blood recovered from the murder scene of his wife matched Simpson’s blood. Even though the odds of the blood sample belong to someone else was extremely remote, the jury remained unconvinced that the sample has not been tampered with. Simpson was ultimately acquitted of the murder charge.

Historical uses of genetic fingerprinting

Jeffreys was first given the opportunity to demonstrate the power of DNA fingerprinting in March of 1985 when he proved a boy was the son of a British citizen and should be allowed to enter the country. In 1986, DNA was first used in forensics. In a village near Jeffreys’ home, a teenage girl was assaulted and strangled. No suspect was found, although body fluids were recovered at the crime scene. When another girl was strangled in the same way, a 19-year-old caterer confessed to one murder but not the other. DNA analysis showed that the same person committed both murders, and the caterer had falsely confessed. Blood samples of 4, 582 village men were taken, and eventually the killer was revealed when he attempted to bribe some-onetotakethe test for him.

The first case to be tried in the United States using DNA fingerprinting evidence was of African-American Tommie Lee Edwards. In November 1987, a judge did not permit population genetics statistics that compared Edwards to a representative population. The judge feared the jury would be overwhelmed by the technical information. The trial ended in a mistrial. Three months later, Andrews was on trial for the assault of another woman. This time the judge did permit the evidence of population genetics statistics. The prosecutor showed that the probability that the chance that Edwards’ DNA would not match the crime evidence was one in 10 billion. Edwards was convicted.

DNA fingerprinting has been used repeatedly to identify human remains. In Cardiff, Wales, skeletal remains of a young woman were found, and a medical artist was able to make a model of the girl’s face. She was recognized by a social worker as a local run-away. Comparing the DNA of the femur of the girl with samples from the presumptive parents, Jeffreys declared a match between the identified girl and her parents. In Brazil, Wolfgang Gerhard, who had drowned in a boating accident, was accused of being the notorious Nazi of Auschwitz, Josef Mengele. Disinterring the bones, Jeffreys and his team used DNA fingerprinting to conclude that the man actually was the missing Mengele.

In addition to forensics, genetic fingerprinting has been used to unite families. In 1976, a military junta in a South American country killed over 9, 000 people, and the orphaned children were given to military couples. After the regime was overthrown in 1983, Las Abuelas (The Grandmothers) were determined to bring these children to their biological families. Using DNA fingerprinting, they found the families of over 200 children. Best-selling murder mystery writer Kathy Reichs was involved in this effort, in her professional capacity as a forensic pathologist.

DNA has been used to solve several historical mysteries. On July 16, 1918, the czar of Russia and his family were shot, doused with sulfuric acid, and buried in a mass grave. In 1989, the site of burial was uncovered, and bone fragments of nine skeletons were assembled. Genetic fingerprinting experts from all over the world pieced together the puzzle that ended in a proper burial to the Romanov royal family in Saint Petersburg in 1998.

See also Amino acid; Gene; Genetic engineering; Forensic science.

Resources

BOOKS

Junkin, Tim. Bloodsworth: The True Story of the First Death Row Inmate Exonerated by DNA. Chapel Hill NC: Algonquin Books, 2004.

Read, M.M. Focus on DNA Fingerprinting Research. Hauppage NY: Nova Biomedical Books, 2006.

Shaler, Robert C. Who They Were: Inside the World Trade Center DNA Story: The Unprecedented Effort to Identify the Missing. New York: Free Press, 2005.

Weinberg, Samantha. Pointing from the Grave: A True Story of Murder and DNA. New York: Miramax Books, 2003.

OTHER

The University of Washington. “Basics of DNA fingerprinting.” <http://www.biology.washington.edu/fingerprint/dnaintro.html,> (accessed October 26, 2006).

DNA Fingerprint

views updated Jun 08 2018

DNA Fingerprint

DNA (deoxyribonucleic acid) represents the blueprint of the human genetic makeup. It exists in virtually every cell of the human body and differs in its sequence of nucleotides (molecules that make up DNA, also abbreviated by letters, A, T, G, C; or, adenine, thymine, guanine, and cytosine, respectively). The human genome is made up of 3 billion nucleotides, which are 99.9% identical from one person to the next. The 0.1% variation, therefore, can be used to distinguish one individual from another. It is this difference that can be used by forensic scientists to match specimens of blood , tissue, or hair follicles to an individual with a high level of certainty.

The complete DNA of each individual is unique, with the exception of identical twins. A DNA fingerprint, therefore, is a DNA pattern that has a unique sequence such that it can be distinguished from the DNA patterns of other individuals. DNA fingerprinting is also called DNA typing.

DNA fingerprinting was first used for sample identification after the geneticist Alec J. Jeffreys from the University of Leicester in Great Britain discovered that there are patterns of genetic material that are unique to almost every individual. He called these repetitive DNA sequences "minisatellites." The two major uses for the information provided by DNA-fingerprinting analysis are for personal identification and for the determination of paternity.

DNA fingerprinting is based on DNA analyzed from regions in the genome that separate genes called introns. Introns are regions within a gene that are not part of the protein the gene encodes. They are spliced out during processing of the messenger RNA, which is an intermediate molecule that allows DNA to encode protein. This is in contrast to DNA analysis looking for disease causing mutations, where the majority of mutations involve regions in the genes that code for protein called exons. DNA fingerprinting usually involves introns because exons are much more conserved and therefore, have less variability in their sequence.

DNA fingerprinting was originally used to identify genetic diseases by linking disease genes within a family based on the inheritance of the segregating markers and the likelihood that they would be in close proximity, but it also became used for criminal investigations and forensic science. In general, the United States courts accept the reliability of DNA analysis and have included these results into evidence in many court cases. However, the accuracy of the results, the cost of testing, and the misuse of the technique have made it controversial.

In forensics laboratories, DNA can be analyzed from a variety of human samples including blood, semen , saliva , urine, hair, buccal (cheek cells), tissues, or bones. DNA can be extracted from these samples and analyzed in a lab and results from these studies are compared to DNA analyzed from known samples. DNA extracted from a sample obtained from a crime scene then can be compared and possibly matched with DNA extracted from the victim or suspect.

DNA can be extracted from two different sources within the cell. DNA found in the nucleus of the cell, also called nuclear DNA (nDNA) is larger and contains all the information that makes us who we are. It is tightly wound into structures called chromosomes. DNA can also be found in an organelle within the cell called the mitochondria, which functions to produce energy that drives all the cellular processes necessary for life. Mitochondrial DNA (mtDNA) is much smaller, contains only 16,569 nucleotide bases (compared with nDNA, which contains 3.9 billion) and it is not wound up into chromosomes. Instead, it is circular and there are many copies of it.

Nuclear DNA is analyzed in evidence containing blood, semen, saliva, body tissues, and hair follicles. DNA from the mitochondria, however, is usually analyzed in evidence containing hair fragments, bones, and teeth. Mitochondrial DNA analysis is typically performed in cases where there is an insufficient amount of sample, the nDNA is uninformative, or if supplemental information is necessary.

Unlike nDNA, where one copy of a chromosome comes from the father and the other from the mother, mtDNA is exclusively inherited from the maternal side. Therefore, the maternal mtDNA should be the same as her offspring. This can be helpful in cases where it is not possible to obtain a sample from the suspect but it is possible to obtain a sample from one of the suspect's biologically related family members. By doing so, the suspect can be excluded as the culprit of a crime if the results indicate that the relevant family member's mtDNA does not match the mtDNA fingerprint from the sample.

Mitochondrial DNA can be informative in a different way than nDNA. Less than 10% of the mitochondrial genome is noncoding and localized in a region called the D-loop. In this region, there are sequence variations that are inherited that can be used for forensic purposes. These regions, called hypervariable regions, are broken down into two sections: HV1 and HV2. It is within these regions that inherited sequence variations can be identified.

One of the main reasons mtDNA analysis can be helpful to forensic scientists is that in some tissues, mitochondrial DNA is in excess compared to nDNA. As nDNA exists in chromosomes and there are only two copies of each chromosome (one inherited maternally, the other paternally) per cell, the nDNA copy number is much smaller. The mitochondrial genome can have a copy number of 2–10 per organelle and in some cases the number of organelles can reach the hundreds. For example, in muscle tissue, where the demand for energy is highest, there are a larger number of copies of the mitochondrial genome. Analysis of mtDNA, therefore, can be particularly helpful in forensic cases where sample integrity or size is compromised or when confirmation is needed.

There are many methods that forensic scientists use to determine the sample's DNA fingerprint. Once DNA is extracted, it can then be analyzed using a variety of molecular genetics techniques. In some cases, there is not enough DNA to directly evaluate it. If this occurs, a technique called the polymerase chain reaction (PCR ) is used to amplify the genomic DNA from a sample. This procedure allows a scientist to amplify a specific sequence of DNA in the genome exponentially, so that it is in large enough quantities to be analyzed.

DNA analysis can be performed by sequencing the amplified DNA fragment using fluorescently labeled nucleotides and a laser that will recognize the nucleotide based on the fluorescent label to which it is attached. This technique is expensive, may not be informative, and is generally not the best approach to DNA fingerprint a sample.

If there is enough DNA, the DNA extracted from the sample can be cut or segmented using specific enzymes (proteins that speed up chemical reactions) called restriction endonucleases that act as molecular scissors by cutting specific sequences that they recognize. By cutting in the same sequence that is present in different locations throughout the genome, a pattern of fragments can be formed. Differences in the sequence patterns between two samples can be due to inherited variations in the DNA that can distinguish two different samples.

Once the DNA is cut, the segments are arranged by size using a process called electrophoresis , whereby an electrical field is generated, pulling the negatively charged DNA toward the positively charged end through a gel-like matrix. The segments are marked with radioactive probes and exposed on x-ray film, where they form a characteristic pattern of black bars. This pattern is called the DNA fingerprint. If the DNA fingerprints produced from two different samples match, the two samples are likely to have come from the same person.

DNA can also be processed and cut with restriction enzymes. If there is a variation in a particular sequence that results in the enzyme no longer recognizing and cutting the DNA (or a loss of the cut site), a larger fragment will be observed when running the DNA in a gel by electrophoresis. Using a chemical that binds to DNA (called ethidium bromide) and fluoresces when it is excited by ultraviolet radiation, the fragments can be observed on a gel based on size. Bigger fragments will migrate more slowly in the gel. An individual with the sequence variation in which the enzyme does not cut would have a longer size fragment than the individual with the variation the enzyme does cut.

The original DNA fingerprinting procedure used Variable Number Tandem Repeats (VNTR), which are repetitive DNA sequences that are spread throughout the genome in noncoding regions. These targets are large, with repeat numbers that are variable from person to person and have a repeat size composed of hundreds of nucleotides which can be repeated a hundred times.

The biggest problem with using the VNTR-fingerprinting approach is that DNA extracted from samples in a crime scene, such as from a dried blood stain, is often broken up into tiny pieces due in most cases to natural DNA-degrading processes. This can make DNA analysis difficult, unless informative fragments remain intact. Additionally, the smaller the sample, the more likely it will be degraded. For example, a plucked hair might contain up to 30 nanograms (30 ng, or 30 billionths of one gram) of genomic DNA, but a hair shaft without the root might maximally only contain 0.1 ng of DNA. The integrity of the sample as well as the quantity, therefore, can make reliable and definitive identity determination difficult.

More recent approaches have circumvented the problem associated with degraded DNA. Shorter repetitive sequences, or short tandem repeats (STR), were later identified and found to contain repeat core units of three, four, or five nucleotides long and have a complete length of only 80–400 nucleotides. Due to the shortness of these sequences, only 50 pg of DNA (which is almost a 1000 times less than that found in a hair shaft without the root) is required. The discriminating power, when analyzing STRs at multiple locations with the genome, can match persons with a probability of 1 in 1015 to a stain. The DNA fingerprint using STR analysis can, therefore, be an extremely powerful technique in forensic sciences.

With the completion of the human genome sequence and the rapid post-genomic characterization of the sequences, it has become easier to analyze samples pertinent for forensic applications. In fact, forensic scientists have been able to link a suspect to the scene of a crime using dried chewing gum, the cells in the saliva from the butt of a cigarette, and cells found underneath fingernails. DNA fingerprinting, therefore, has revolutionized the forensic sciences by its use in investigations and prosecutions of active criminal cases, missing persons investigations, re-examining dead-end cases, post-conviction exoneration, and studies where maternal relatedness is in question.

see also Analytical instrumentation; Chemical and biological detection technologies; DNA profiling; DNA recognition instruments; RFLP (restriction fragment length polymorphism).

DNA Fingerprinting

views updated May 14 2018

DNA Fingerprinting

DNA fingerprinting is the term applied to a range of techniques that are used to show similarities and dissimilarities between the DNA present in different individuals.

DNA fingerprinting is an important tool in the arsenal of forensic investigators and intelligence officers. In an era when plastic surgery can be used to alter a terrorist's appearance, DNA fingerprinting allows for positive identification not only of body remains, but also of suspects in custody. DNA fingerprinting can also link physical evidence from incidents that occur in different parts of the world.

Sir Alec Jeffreys at the University of Leicester developed DNA fingerprinting in the mid 1980s. The sequence of nucleotides in DNA is similar to a fingerprint, in that it is unique to each person. DNA fingerprinting is used for identifying people, studying populations, and forensic investigations.

Historical Uses of DNA Fingerprinting

Jeffreys was first given the opportunity to demonstrate the power of DNA fingerprinting in March of 1985 when he proved a boy was the son of a British citizen and should be allowed to enter the country. In 1986, DNA was first used in forensics. In a village near Jeffreys' home, a teenage girl was assaulted and strangled. No suspect was found, although body fluids were recovered at the crime scene. When another girl was strangled in the same way, a 19-year-old caterer confessed to one murder but not the other. DNA analysis showed that the same person committed both murders, and the caterer had falsely confessed. Blood samples of 4582 village men were taken, and eventually the killer was revealed when he attempted to bribe someone to take the test for him.

The first case to be tried in the United States using DNA fingerprinting evidence was of African-American Tommie Lee Edwards. In November 1987, a judge did not permit population genetics statistics that compared Edwards to a representative population. The judge feared the jury would be overwhelmed by the technical information. The trial ended in a mistrial. Three months later, Andrews was on trial for the assault of another woman. This time the judge did permit the evidence of population genetics statistics. The prosecutor showed that the probability that Edwards' DNA would not match the crime evidence was one in ten billion. Edwards was convicted.

DNA fingerprinting has been used repeatedly to identify human remains. In Cardiff, Wales, skeletal remains of a young woman were found, and a medical artist was able to make a model of the girl's face. She was recognized by a social worker as a local run-away. Comparing the DNA of the femur of the girl with samples from the presumptive parents, Jeffreys declared a match between the identified girl and her parents. In Brazil, Wolfgang Gerhard, who had drowned in a boating accident, was accused of being the notorious Nazi of Auschwitz, Josef Mengele. Disinterring the bones, Jeffreys and his team used DNA fingerprinting to conclude that the man actually was the missing Mengele.

In addition to forensics, DNA has been used to unite families. In 1976, a military junta in a South American country killed over 9000 people, and the orphaned children were given to military couples. After the regime was overthrown in 1983, Las Abuelas (The Grandmothers) determined to bring these children to their biological families. Using DNA fingerprinting, they found the families of over 200 children.

DNA has been used to solve several historical mysteries. On July 16, 1918, the czar of Russia and his family were shot, doused with sulfuric acid, and buried in a mass grave. In 1989, the site of burial was uncovered, and bone fragments of nine skeletons were assembled. DNA fingerprinting experts from all over the world pieced together the puzzle that ended in a proper burial to the Romanov royal family in Saint Petersburg in 1998.

The Mechanics of DNA Fingerprinting

The nucleus of every cell in the human body contains deoxyribonucleic acid or DNA, a biochemical molecule that is made up of nearly three-billion nucleotides. DNA consists of four different nucleotides, adenine (A), thymine (T), guanine (G), and cytosine (C), which are strung together in a sequence that is unique to every individual. The sequence of A, T, G, and C in human DNA can be found in more combinations or variations than there are humans. The technology of DNA fingerprinting is based on the assumption that no two people have the same DNA sequence.

The DNA from a small sample of human tissue can be extracted using biochemical techniques. Then the DNA can be digested using a series of enzymes known as restriction enzymes, or restriction endonucleases. These molecules can be thought of as chemical scissors, which cut the DNA into pieces. Different endonucleases cut DNA at different parts of the nucleotide sequence. For example, the endonuclease called SmaI cuts the sequence of nucleotides CCCGGG between the third cytosine (C) and the first guanine (G).

After being exposed to a group of different restriction enzymes, the digested DNA undergoes gel electrophoresis. In this biochemical analysis technique, test samples of digested DNA are placed in individual lanes on a sheet of an agarose gel that is made from seaweed. A separate lane contains control samples of DNA of known lengths. The loaded gel is then placed in a liquid bath and an electric current is passed through the system. The various fragments of DNA are of different sizes and different electrical charges. The pieces move according to their size and charge with the smaller and more polar ones traveling faster. As a result, the fragments migrate down the gel at different rates.

After a given amount of time, the electrical current in the gel electrophoresis instrumentation is shut off. The gel is removed from the bath and the DNA is blotted onto a piece of nitrocellulose paper. The DNA is then visualized by the application of radioactive probe that can be picked up on a piece of x-ray film. The result is a film that contains a series of lines showing where the fragments of DNA have migrated. Fragments of the same size in different lanes indicate the DNA has been broken into segments of the same size. This demonstrates a similarity between the sequences under test.

Different enzymes produce different banding patterns and normally several different endonucleases are used in conjunction to produce a high definition banding pattern on the gel. The greater the number of enzymes used in the digestion, the finer the resultant resolution.

In DNA fingerprinting, scientists focus on segments of DNA in which nucleotide sequences vary a great deal from one individual to another. For example, five to ten percent of the DNA molecule contains regions that repeat the same nucleotide sequence many times, although the number of repeats varies from person to person. Jeffreys targeted these long repeats called variable number of tandem repeats (VNTRs) when he first developed DNA fingerprinting. The DNA of each person also has different restriction fragment sizes, called restriction fragment length polymorphisms (RFLPs), which can be used as markers of differences in DNA sequences between people. Today, technicians also use short tandem repeats (STRs) for DNA fingerprinting. STRs are analyzed using polymerase chain reaction or PCR, a technique for mass-producing sequences of DNA. PCR allows scientists to work with degraded DNA.

Use as a forensic tool. DNA fingerprinting is now an important tool in the arsenal of forensic chemists. It is used in forensics to examine DNA samples taken from a crime scene and compare them to those of a suspect. Criminals almost always leave evidence of their identity that contains DNA at the crime scene—hair, blood, semen, or saliva. These materials can be carefully collected from the crime scene and fingerprinted

Although DNA fingerprinting is scientifically sound, the use of DNA fingerprinting in courtrooms remains controversial. There are several objections to its use. Lawyers who misrepresent the results of DNA fingerprints may confuse jurors. DNA fingerprinting relies on the probability that individuals will not produce the same banding pattern on a gel after their DNA has been fingerprinted. Establishing this probability relies on population statistics. Each digested fragment of DNA is given a probability value. The value is determined by a formula relating the combination of sequences occurring in the population. There is concern that not enough is known about the distribution of banding patterns of DNA in the population to express this formula correctly. Concerns also exist regarding the data collection and laboratory procedure associated with DNA fingerprinting procedures. For example, it is possible that cells from a laboratory technician could be inadvertently amplified and run on the gel. However, because each person has a unique DNA sequence and this sequence cannot be altered by surgery or physical manipulation, DNA fingerprinting is an important tool for solving criminal cases.

█ FURTHER READING:

BOOKS:

Griffiths, A., et al. Introduction to Genetic Analysis, 7th ed. New York: W.H. Freeman and Co., 2000.

Jorde, L. B., J. C. Carey, M. J. Bamshad, and R. L. White. Medical Genetics, 2nd ed. Mosby-Year Book, Inc., 2000.

Klug, W., and M. Cummings. Concepts of Genetics, 6th ed. Upper Saddle River: Prentice Hall, 2000.

Watson, J. D., et al. Molecular Biology of the Gene, 4th ed. Menlo Park, CA: The Benjamin/Cummings Publishing Company, Inc., 1987.

ELECTRONIC:

The University of Washington. "Basics of DNA fingerprinting." <http://www.biology.washington.edu/fingerprint/dnaintro.html,>(March 4, 2003).

SEE ALSO

DNA Recognition Instruments
DNA Sequences, Unique
Fingerprint Analysis
Genomics
Retina and Iris Scans

DNA Fingerprinting

views updated May 23 2018

DNA fingerprinting

Genetic, genomic, or DNA fingerprinting is the term applied to a range of techniques that are used to show similarities and dissimilarities between the DNA present in different individuals.

Genetic fingerprinting is an important tool in the arsenal of forensic investigators. Genetic fingerprinting allows for positive identification, not only of body remains, but also of suspects in custody. Genetic fingerprinting can also link suspects to physical evidence.

Sir Alec Jeffreys at the University of Leicester developed DNA fingerprinting in the mid 1980s. The sequence of nucleotides in DNA is similar to a fingerprint, in that it is unique to each person. DNA fingerprinting is used for identifying people, studying populations, and forensic investigations.


The mechanics of genetic fingerprinting

The nucleus of every cell in the human body contains deoxyribonucleic acid or DNA, a biochemical molecule that is made up of nearly three-billion nucleotides. DNA consists of four different nucleotides, adenine (A), thymine (T), guanine (G), and cytosine (C), which are strung together in a sequence that is unique to every individual . The sequence of A, T, G, and C in human DNA can be found in more combinations or variations than there are humans. The technology of DNA fingerprinting is based on the assumption that no two people have the same DNA sequence.

The DNA from a small sample of human tissue can be extracted using biochemical techniques. Then the DNA can be digested using a series of enzymes known as restriction enzymes, or restriction endonucleases. These molecules can be thought of as chemical scissors, which cut the DNA into pieces. Different endonucleases cut DNA at different parts of the nucleotide sequence. For example, the endonuclease called SmaI cuts the sequence of nucleotides CCCGGG between the third cytosine (C) and the first guanine (G).

After being exposed to a group of different restriction enzymes, the digested DNA undergoes gel electrophoresis . In this biochemical analysis technique, test samples of digested DNA are placed in individual lanes on a sheet of an agarose gel that is made from seaweed. A separate lane contains control samples of DNA of known lengths. The loaded gel is then placed in a liquid bath and an electric current is passed through the system. The various fragments of DNA are of different sizes and different electrical charges. The pieces move according to their size and charge with the smaller and more polar ones traveling faster. As a result, the fragments migrate down the gel at different rates.

After a given amount of time , the electrical current in the gel electrophoresis instrumentation is shut off. The gel is removed from the bath and the DNA is blotted onto a piece of nitrocellulose paper . The DNA is then visualized by the application of radioactive probe that can be picked up on a piece of x-ray film. The result is a film that contains a series of lines showing where the fragments of DNA have migrated. Fragments of the same size in different lanes indicate the DNA has been broken into segments of the same size. This demonstrates a similarity between the sequences under test.

Different enzymes produce different banding patterns and normally several different endonucleases are used in conjunction to produce a high definition banding pattern on the gel. The greater the number of enzymes used in the digestion, the finer the resultant resolution.

In genetic or DNA fingerprinting, scientists focus on segments of DNA in which nucleotide sequences vary a great deal from one individual to another. For example, 5–10% of the DNA molecule contains regions that repeat the same nucleotide sequence many times, although the number of repeats varies from person to person. Jeffreys targeted these long repeats called variable number of tandem repeats (VNTRs) when he first developed DNA fingerprinting. The DNA of each person also has different restriction fragment sizes, called restriction fragment length polymorphisms (RFLPs), which can be used as markers of differences in DNA sequences between people. Today, technicians also use short tandem repeats (STRs) for DNA fingerprinting. STRs are analyzed using polymerase chain reaction or PCR , a technique for mass-producing sequences of DNA. PCR allows scientists to work with degraded DNA.


Genetic fingerprinting as a forensic tool

Genetic fingerprinting is now an important tool in the arsenal of forensic chemists. It is used in forensics to examine DNA samples taken from a crime scene and compare them to those of a suspect. Criminals almost always leave evidence of their identity that contains DNA at the crime scene—hair, blood , semen, or saliva. These materials can be carefully collected from the crime scene and fingerprinted

Although DNA fingerprinting is scientifically sound, the use of DNA fingerprinting in courtrooms remains controversial. There are several objections to its use. Lawyers who misrepresent the results of DNA fingerprints may confuse jurors. DNA fingerprinting relies on the probability that individuals will not produce the same banding pattern on a gel after their DNA has been fingerprinted. Establishing this probability relies on population statistics . Each digested fragment of DNA is given a probability value. The value is determined by a formula relating the combination of sequences occurring in the population. There is concern that not enough is known about the distribution of banding patterns of DNA in the population to express this formula correctly. Concerns also exist regarding the data collection and laboratory procedure associated with DNA fingerprinting procedures. For example, it is possible that cells from a laboratory technician could be inadvertently amplified and run on the gel. However, because each person has a unique DNA sequence and this sequence cannot be altered by surgery or physical manipulation, DNA fingerprinting is an important tool for solving criminal cases.

Historical uses of genetic fingerprinting

Jeffreys was first given the opportunity to demonstrate the power of DNA fingerprinting in March of 1985 when he proved a boy was the son of a British citizen and should be allowed to enter the country. In 1986, DNA was first used in forensics. In a village near Jeffreys' home, a teenage girl was assaulted and strangled. No suspect was found, although body fluids were recovered at the crime scene. When another girl was strangled in the same way, a 19-year-old caterer confessed to one murder but not the other. DNA analysis showed that the same person committed both murders, and the caterer had falsely confessed. Blood samples of 4,582 village men were taken, and eventually the killer was revealed when he attempted to bribe someone to take the test for him.

The first case to be tried in the United States using DNA fingerprinting evidence was of African-American Tommie Lee Edwards. In November 1987, a judge did not permit population genetics statistics that compared Edwards to a representative population. The judge feared the jury would be overwhelmed by the technical information. The trial ended in a mistrial. Three months later, Andrews was on trial for the assault of another woman. This time the judge did permit the evidence of population genetics statistics. The prosecutor showed that the probability that the chance that Edwards' DNA would not match the crime evidence was one in 10 billion. Edwards was convicted.

DNA fingerprinting has been used repeatedly to identify human remains. In Cardiff, Wales, skeletal remains of a young woman were found, and a medical artist was able to make a model of the girl's face. She was recognized by a social worker as a local run-away. Comparing the DNA of the femur of the girl with samples from the presumptive parents, Jeffreys declared a match between the identified girl and her parents. In Brazil, Wolfgang Gerhard, who had drowned in a boating accident, was accused of being the notorious Nazi of Auschwitz, Josef Mengele. Disinterring the bones, Jeffreys and his team used DNA fingerprinting to conclude that the man actually was the missing Mengele.

In addition to forensics, Genetic fingerprinting has been used to unite families. In 1976, a military junta in a South American country killed over 9,000 people, and the orphaned children were given to military couples. After the regime was overthrown in 1983, Las Abuelas (The Grandmothers) determined to bring these children to their biological families. Using DNA fingerprinting, they found the families of over 200 children.

DNA has been used to solve several historical mysteries. On July 16, 1918, the czar of Russia and his family were shot, doused with sulfuric acid , and buried in a mass grave. In 1989, the site of burial was uncovered, and bone fragments of nine skeletons were assembled. Genetic fingerprinting experts from all over the world pieced together the puzzle that ended in a proper burial to the Romanov royal family in Saint Petersburg in 1998.

See also Amino acid; Gene; Genetic engineering; Forensic science.


Resources

books

Griffiths, A., et al. Introduction to Genetic Analysis. 7th ed. New York: W.H. Freeman and Co., 2000.

Jorde, L.B., J. C. Carey, M. J. Bamshad, and R. L. White. Medical Genetics. 2nd ed. Mosby-Year Book, Inc., 2000.

Klug, W., and M. Cummings. Concepts of Genetics. 6th ed. Upper Saddle River: Prentice Hall, 2000.

Watson, J.D., et al. Molecular Biology of the Gene. 4th ed. Menlo Park, CA: The Benjamin/Cummings Publishing Company, Inc., 1987.

other

The University of Washington. "Basics of DNA fingerprinting." [cited March 4, 2003] <http://www.biology.washington.edu/fingerprint/dnaintro.html>.

DNA Typing Systems

views updated Jun 08 2018

DNA Typing Systems

Deoxyribonucleic acid (DNA ) typing is a way to categorize an individual's genetic makeup in order to distinguish one individual from another. This has been made possible due to the rapid acceleration of genomics-based technologies coupled with the fact that human genomic DNA, which is comprised of 3 billion bases (letters in the DNA alphabet), is unique in only 0.1% of its makeup. Therefore, approximately 3 million bases differ from one person to the next, allowing scientists to use these differences to perform identity matches with a high degree of certainty. These variable regions of DNA can be used to generate a DNA profile of an individual, using samples from blood , bone, hair, semen , and saliva , as well as other body tissues.

In DNA typing, there are several systems that can be employed to characterize DNA from a sample. These systems have different applications and purposes. For example, in forensics, scientists may need to obtain DNA from a crime scene in order to analyze a specific set of DNA markers (regions within the genome that are variable) rapidly, yet with good results. DNA typing systems that have previously been used or are currently being used in forensics include restriction fragment length polymorphism (RFLP ) typing, short tandem repeat (STR) typing, single nucleotide polymorphism (SNP) typing, mitochondrial DNA (mtDNA) analysis, human leukocyte Antigen (HLA) typing, gender typing, and Y-chromosome typing. RLFP analysis was the first major DNA typing system used in forensics. All of the techniques that followed could not have been developed without the discovery of a revolutionizing methodology called the polymerase chain reaction , or PCR . PCR allows a scientist to amplify genomic DNA (small sequences up to a few thousand in length) extracted from a sample so that there are sufficient quantities to be analyzed.

RFLP analysis was first developed by Alec Jeffreys. RFLPs can be used to analyze the DNA directly in a way that is fairly inexpensive. In RFLP analysis, genomic DNA is digested with a molecular enzyme that cuts the DNA at specific sequences it recognizes, creating multiple fragments. These fragments can be variable depending on whether the enzyme cuts at a particular site in the DNA. Variable DNA that is inherited (and not mutated) at a site may or may not be cut by the enzyme depending on whether the sequence contains the enzyme recognition site. These sites can be highly variable based on inheritance patterns. For this reason, a pattern of fragments will be produced based on the number of cut sites, separated by gel electrophoresis , transferred to a nitrocellulose membrane, and using radio-labeled probes (short sequences of DNA that bind to the complementary sequence from the sample DNA) that bind to specific sequences of interest, they can be identified by audioradiography. Radioactively labeled probes are visualized by audioradiography, or what appears to be film that has burned bands, based on size, that run in the gel during gel electrophoresis. If there is a lack of a restriction site in an individual's DNA at a specific site, the enzyme will not cut it and the fragment will therefore be larger. RFLP analysis is not always applicable because it requires a large amount of high quality DNA. In forensics, samples obtained from a crime scene tend to be degraded. Although RFLP is one of the original applications of DNA analysis that forensic investigators used, newer, more efficient DNA-analysis techniques have replaced this technology.

PCR-based assays followed RFLP analysis because of their greater sensitivity, simplicity, and amenability to analyzing degraded DNA samples. PCR can amplify extremely small amounts of DNA (even DNA from a single cell) to large DNA concentrations (nanograms). Using PCR to amplify a specific sequence of interest, which contains a variable sequence within the amplicon (amplified PCR fragment), STR analysis can be performed. STRs are short tandem repeats of 2–5 base pairs that are repeated a few to dozens of times. Identification of the STR can be performed by direct DNA sequencing . However, it is most often analyzed using gel electrophoresis (if the difference in tandem repeat is large enough) with ethidium bromide, a carcinogen that inserts DNA and fluoresces with an ultraviolet lamp. As the size of the amplified STR loci is in the range of 200–500 base pairs, it makes it ideal for degraded DNA samples.

The Federal Bureau of Investigation (FBI ) uses a set of thirteen specific STR regions for CODIS , a software program that comes from a database derived from local, state, and national agencies using information collected from criminals or arrested individuals. With these markers, it is estimated that there is approximately a one in one billion chance that two individuals will be the same at the thirteen different marker sites.

Another DNA typing system, which is used most frequently in forensics, is mitochondrial DNA analysis . Mitochondrial DNA (mtDNA) is DNA that comes from a source separate from the DNA found in the nucleus. It is much smaller (only 16.5 thousand bases) than nuclear DNA and is important for producing proteins that are important and specific to energy production within the cell. The advantage of using mtDNA is because many tissues (such as muscle) have a much higher copy number of mtDNA compared to nuclear DNA, which only has two copies of genetic information and two sex chromosomes. For samples with little DNA recovered, mtDNA analysis is the preferred approach. It is also important for samples that do not have nucleus, such as red blood cells, rootless hair, bones, nail clippings, and teeth. For these tissues, STR and RFLP analysis cannot be used. Finally, mtDNA analysis is possible due to a highly variable region (by 1–2% in unrelated individuals) in the mtDNA genome called the "D-loop." Mitochondrial DNA is maternally inherited.

Y-chromosome analysis is only applicable in cases that test for identity matches in males. Y-chromosomes can only be inherited by sons from fathers. It can also be useful in testing male suspects when multiple sample sources have been identified at a crime scene. Gender typing can also be performed by analyzing the X-chromosome and determining if there is one allele (male) or two different alleles (female) at an informative site.

Another DNA typing system, used in particular by forensic scientists, involves designing small pieces of short DNA sequences called "probes" that bind to complementary DNA sequences extracted from a sample found at a crime scene. Much like the radiolabeled probes, these short sequences can be used to create a distinct pattern depending on the DNA source. These patterns can be compared to the sample from a crime scene and determined if a match exists between the DNA from the sample and the DNA from the suspect. These probes can be fluorescently labeled and used to identify Small Nucleotide Polymorphisms (SNPs), which are single base variations that are known to be variable within a given population, are not themselves disease-causing, do not represent spontaneous mutations, and are found throughout the genome. A marker is only informative if there is a difference between two samples. Although a single SNP may not be informative, combining several SNPs is useful and can easily be automated. The more markers that are used, the likelihood that the two samples are identical is greater.

Although six or more probes are usually used in forensics DNA typing, new, more advanced DNA typing systems are being developed. DNA-chip technology is the latest molecular advancement that will considerably speed up analysis and allow forensic scientists to study many sequences at one time in a fully automated manner. DNA chips (also known as microarrays) have small sequences printed or synthesized onto microscopic spots on a tiny chip. When DNA is added to the chip, binding of the sample to the probe occurs when there is a match. The probes are labeled with a fluorescent dye that fluoresces when it hybridizes to a sequence from the sample DNA. Different fluorochromes (colors) can be used to distinguish which DNA base is present in a variable position of the DNA sequence.

Despite its speed, this type of DNA technology is more expensive and probably better suited for applications where a large number of suspects' samples are required for DNA typing. It might also apply DNA typing to identify the remains of many different individuals from a natural disaster. For example, after the tsunami that developed off the west coast of the Indonesian islands in 2004, coastal regions in Thailand and other Asian countries were devastated by its destruction. Many visitors' and residents' remains were found but could not be identified. Microarray-based DNA typing would have been helpful in characterizing the DNA patterns from the remains and matching them to various samples.

After the discovery of PCR, a DNA typing system that was used in forensics was the HLA DQ a / HLA DQA1 system, or Human Leukocyte Antigen (HLA) system. This system is comprised of a 242 base area in the genome that is highly variable in the population. It can be detected using molecular probes that seek out complementary subregions within this genetic region. The probe for HLA DQa set started out with six common sites called DQ alleles that, when combined, produced 21 possible genotypes. With only one locus or region in the genome used, the predictive value was lower than RFLP analysis or other PCR-based assays. The HLA DQA1 system improved the analysis by detecting 28 possible genotypes. The AmpliType PM+DQA1, another HLA-related locus, was developed to expand the HLA DQ system. It uses several markers at different loci (the location of a particular gene on a chromosome ), analyzed simultaneously (also called multiplexing). With five additional markers analyzed, the statistical power increases considerably.

see also Analytical instrumentation; Chemical and biological detection technologies; DNA fingerprint; DNA profiling; DNA recognition instruments; DNA sequences, unique; Mitochondrial DNA typing.

DNA Sequences, Unique

views updated May 18 2018

DNA Sequences, Unique

█ AGNIESZKA LICHANSKA

Deoxyribonucleic acid (DNA) contains genetic information of an organism that is unique for each organism. The entire cellular DNA of any organism, bacteria, plant or animal is known as its genome, as is the entire genetic material of a virus. A DNA sequence is considered to be unique if it is present in only one copy in a haploid genome. A haploid genome contains only a single copy of each chromosome. In humans, for example, a haploid number of chromosomes is 23. However, not all of the DNA contained in the genome is considered as unique; there are also various repetitive sequences present.

DNA and Genome Structure

A DNA strand is composed of a strand of nucleotides (nitrogen-based building blocks of DNA and RNA). Each nucleotide contains a phosphate attached to a sugar molecule (deoxiribose) and one of four bases, guanine (G), cytosine (C), adenine (A) or thymine (T). It is the arrangement of the bases in a sequence, for example ATTGCCAT, that determines the encoded gene. This sequence allows scientists to identify organisms, genes, or fragments of genes. One of the main characteristics of DNA is the fact that it forms double stranded molecules (helices) by forming hydrogen bonds between the complementary strands inside the helix and a sugar-phosphate backbone outside. This pairing is not random, A always pairs with T, and C pairs with G; therefore, a sequence complementary to ATTCCGAT will be TAAGGCTA.

Genes are the sequences of encoded proteins, and together with the surrounding regulatory sequences are, considered as unique genomic sequences, because they are present as single copies in a haploid genome. In contrast, some sequences are present in multiple copies and are known as repetitive fragments. The simplest genomes of viruses and bacteria contain mostly unique sequences with only a few repetitive regions. However, the proportion of repetitive DNA increases in higher organisms, for example sea urchins have only 38% unique sequences and human just over 50%.

The genes encoding the same protein in bacteria, plants, and humans show some similarity as the majority of the encoded proteins perform the same or similar function across the species. Such homology between the sequences allows scientists to identify the genes in humans by using fragments of mouse or yeast genes to search for similar DNA fragments. Although most of the genes show some species-dependent differences, not all of them can be used to discriminate between organisms. Only a few genes can be used for this purpose. The two main groups are ribosomal (16S in bacteria and 18S in animals) and mitochondrial genes.

Ribosomal genes are useful for tracing evolution and relationships, especially in bacteria. However, mitochondrial genes have an advantage over the ribosomal genes as they are not encoded by the nuclear DNA, but are present as circular molecules in the cells. As such they are less likely to be degraded with time; therefore bones, teeth, or tissue fragments can be identified even after a long time.

Exploiting Unique DNA Sequences

The presence of unique DNA sequences allows scientists to identify signature sequences that can be later used as probes to detect individual organisms or to detect a particular gene. Changes of even one base pair can be readily detected by most hybridization techniques and by sequencing. Signature sequences are particularly important for diagnosis of viruses, which are the pathogens that lack ribosomal or mitochondrial genes. Their detection and identification is greatly simplified by using these sequences, as traditional methods can take up to a few weeks.

The unique DNA sequences can also be used to design primers (short DNA fragments needed to initiate DNA amplification) for polymerase chain reaction (PCR). There is adequate difference between all the genes within one organism, as well as between organisms from different species, to ensure that the selected primers will only amplify the target sequence even if a mixture of different DNA molecules is present. This allows scientists to design diagnostic and identification tests for the common pathogens and diseases and for parts of the pathogen's genome.

Identification of people. Although every person has unique DNA (except for the identical twins), identification of people is not based on the sequencing of someone's genome. Instead, analysis of mitochondrial DNA in a region of a displacement-loop (D-loop or control region) or of short tandem repeats (STRs) is used for identification purposes. D-loop analysis is used for individual identification in forensic analysis. This is possible due to the polymorphisms of such sequences resulting from substitutions of base pairs during DNA replication process (for example, instead of A, DNA polymerase incorporates T).

The D-loop region is 1274 base pairs long and is located between the genes encoding transfer RNA (tRNA) for proline and tRNA for phenylalanine and contains the regulatory regions of the for replication other genes.

The main method used for the identification of the changes in this region is PCR amplification and sequencing. However, new microarray approaches are under development.

Encoding secret messages. DNA sequences offer a unique method of encrypting messages or concealing information. A DNA sequence encoding a message is flanked on the sites by primers that will be later used to amplify if by PCR and sequence. An encryption code is selected by a group that is using the system; for example, each letter and number might be assigned three base pairs. The DNA strand with a message is prepared and mixed with human genomic DNA fractionated to the same size as the message. To further conceal the DNA from an enemy, DNA from another species can be added. An intended recipient of the message can decode it by PCR amplification and sequencing. Sending such as message is as simple as writing a letter and enclosing the DNA coded message as a microdot. Once the DNA mix is prepared, it is spotted over a dot on paper from which the microdots are cut out and attached to the full stops in the letter. If such a letter falls into the wrong hands finding a message will be extremely difficult, as it will be buried among millions of others, and reading it without the primer sequences and encryption code will be impossible.

DNA encrypted messages can be used for safekeeping important information, but also to pass on espionage information. Although the method is simple, it requires molecular biology equipment to decode and can be too troublesome for everyday use.

Use of Unique DNA Sequences

Unique DNA sequences are already used as security tools. The ability to synthetically create DNA molecules allows the generation not only of spy messages, but more importantly, unique signatures that would protect consumers from product fakes. Similar methods were used at the Sydney Olympic Games in 2000 to mark all of the official merchandise. In this case, an invisible ink mixed with DNA obtained from one of the athletes was used. Protection is not limited to manufacturers. Unique DNA sequences are also used by artists such as Thomas Kinkade and cartoon creator Joseph Barbera, who protect their artwork by DNA signatures.

The major use of unique DNA sequences for security, however, is in the area of environmental surveillance and identification of agents of biological warfare. The sequences used for these purposes are often kept secret. Most of the producers of DNA recognition instruments use such sequences to design their products.

Finally, forensic science relies in many cases on the use of unique sequences for identification of biological traces and individual identification.

█ FURTHER READING:

BOOKS:

Strachan, Tom, and Andrew P. Read. Human Molecular Genetics, 2nd ed. Oxford: BIOS Scientific Publishers, 1999.

Hartl, Daniel L. Genetics. Boston: Jones and Bartlett, 1994.

PERIODICALS:

Clelland, C. T., V. Risca, and C. Bancroft. "Hiding Messages in DNA Microdots." Nature no. 6736 (1999): 533–534.

ELECTRONIC:

Wired News. "DNA Tagging." Stewart Taggart. <http://www.wiredcom/news/print/0,1294,34774,00.html> (15 January 2003).

SEE ALSO

DNA Fingerprinting
DNA Recognition Instruments
Polymerase Chain Reaction (PCR)

CODIS: Combined DNA Index System

views updated May 21 2018

CODIS: Combined DNA Index System

CODIS, or the Combined DNA Index System, is a database and electronic search engine that allows crime laboratories throughout the United States to exchange DNA information about criminals, suspects, and victims of crime. CODIS is operated by the U.S. Department of Justice through the Federal Bureau of Investigation.

The CODIS project began in 1990 as a collaboration among 14 forensic laboratories. The DNA Identification Act of 1994 authorized the use of DNA data for forensic analysis and formalized CODIS. By October 1998, CODIS became operational on a national level. As of 2004, all 50 states along with Puerto Rico, the U.S. Army and the FBI were CODIS participants.

CODIS has a three-tiered hierarchical structure. DNA information originates at the local level (LDIS, Local DNA Index System), where biological samples are taken at police departments and sheriffs' offices. Data from the LDIS then flows into the state (SDIS, State DNA Index System) and the national (NDIS , National DNA Index System) databases. SDIS provides a means for local crime labs within a state to exchange information. The NDIS allows for the exchange of DNA profiles on the broadest scale at the national level. The hierarchical nature of CODIS allows investigators to use their databases according to the specific laws under which they operate.

CODIS consists of two major indexes. The Forensic Index contains DNA information from the crime scene, including DNA information found on the victim. The Offender Index contains DNA profiles of convicted felons. Most states require all people convicted of sexual offenses, as well as many convicted of violent crimes, to provide genetic information to CODIS. As of December 2004, CODIS contained 2,132,470 DNA profiles. The large majority, about 2 million, were made up of DNA profiles from convicted offenders and were included in the Offender Index. The Forensic Index contained approximately 100,000 samples.

In addition, CODIS contains ancillary information that provides additional information for investigators to use in order to solve crimes. One index catalogues information collected from unidentified human remains and another collects DNA profiles voluntarily donated by the relatives of missing persons. CODIS also includes a population file consisting of anonymously donated DNA profiles. This file is used to quantify the statistical significance of a match.

Information entered into the Forensic Index from different locations in the United States can help link crimes together. For example, if the DNA profile taken from a crime scene in Tallahassee matches that taken from a crime scene in Miami, then there is evidence that the same person committed the crimes. This allows investigators to develop more leads and coordinate investigations. When a DNA profile from the Forensic Index matches one from the Offender Index, a suspect can be identified. After CODIS provides investigators with a potential match, experts in crime labs are always consulted for verification.

A DNA profile that is entered into CODIS consists of information that is gathered from stretches of the chromosome that are highly variable between different people. These variable regions are called polymorphisms. One type of polymorphism is a very short sequence of nucleotides, the building blocks of DNA, which repeats itself many times. This type of sequence is called a short tandem repeat, or STR. STRs are usually between two and five nucleotides long, and CODIS profiles specifically catalogue those that are four nucleotides long. STRs that are four nucleotides in length are referred to as tetramers. For example, the sequence of nucleotides "CGAACGAACGAACGAACGAA" represents five copies of the tetramer "CGAA." The number of times that "CGAA" repeats itself at a given location on the chromosome will vary from person to person. The CODIS core profile consists of STR information gathered from 13 different loci, or positions, on the chromosomes.

CODIS has been an extremely successful system that has aided in solving a variety of investigations. As of December 2004, CODIS produced more than 19,000 hits, which are defined as matches between suspect and crime that would not have been made without CODIS. CODIS has also assisted in solving 20,700 criminal cases in 47 states. Many of the investigations aided by CODIS have developed leads against sexual offenders. For example, in 1999, Virginia police received a phone call from a woman who had been stabbed and raped. By the time they arrived on the scene, the woman had bled to death. After gathering biological evidence from the woman's body, investigators developed a DNA profile of the suspect. Using CODIS, they produced a match in the Offender Index to a rapist who had been imprisoned in Virginia in 1989, but who had served out his term and been released. In another case, in 1996, two rapes occurred at in distant parts of St. Louis, both involving young girls who had been waiting at bus stops. The St. Louis Police Department was unable to solve the crimes. In 1999, they reanalyzed DNA evidence from the crimes and were able to generate a hit through CODIS to an offender in another rape case. He was eventually identified as the offender in both of the bus stop crimes. CODIS also played a role in the September 11, 2001 attacks. In the days following the attacks, the company that helped develop the CODIS software worked with the FBI and the New York Police Department to modify the software so that it could be used to identify the remains of those killed in the attacks.

see also FBI crime laboratory; FBI (United States Federal Bureau of Investigation); Identification.

DNA Sequences, Unique

views updated May 29 2018

DNA Sequences, Unique

An increasingly important facet of forensic science is the use of techniques that detect and determine the structure of deoxyribonucleic acid (DNA ). When the aim of the investigation is to identify an unknown person, the exploitation of unique portions of DNA can be very useful.

DNA contains genetic information that is unique to each organism. The entire cellular DNA of any organism, bacteria, plant, virus, or animal represents the genome. A DNA sequence is considered to be unique if it is present in only one copy in a haploid genome (that portion of DNA that contains only a single copy of each chromosome ). In humans, for example, a haploid number of chromosomes is 23.

Not all of the DNA contained in the genome is unique; there are also various repetitive sequences present.

A DNA strand is composed of a strand of nucleotides (nitrogen-based building blocks of DNA and ribonucleic acid; RNA). Each nucleotide contains a phosphate attached to a sugar molecule (deoxyribose) and one of four bases, guanine (G), cytosine (C), adenine (A), or thymine (T).

It is the arrangement of the bases in a sequence, for example ATTGCCAT, that determines the encoded gene . This sequence allows scientists to identify organisms, genes, or fragments of genes.

One of the main characteristics of DNA is the fact that it forms double stranded molecules (helices) by forming hydrogen bonds between the complementary strands inside the helix and a sugar-phosphate backbone outside. This pairing is not random, A always pairs with T, and C pairs with G, therefore a sequence complementary to ATTCCGAT will be TAAGGCTA.

Genes are the sequences of encoded proteins, and, together with the surrounding regulatory sequences, are considered as unique genomic sequences, since they are present as single copies in a haploid genome. In contrast, some sequences are present in multiple copies. These represent repetitive fragments. The simplest genomes of viruses and bacteria contain mostly unique sequences with only a few repetitive regions. However, the proportion of repetitive DNA increases in higher organisms, for example sea urchins have only 38% unique sequences and human just over 50%.

Genes encoding the same protein in bacteria, plants, and humans often display similar genetic sequences and perform the same or similar function across the spectrum of organisms. Such homology between the sequences allows scientists to identify the genes in humans by using fragments of mouse or yeast genes to search for similar DNA fragments. Although most of the genes show some species-dependent differences, not all of them can be used to discriminate between organisms. Only a few genes can be used for this purpose. The two main groups are ribosomal (16S in bacteria and 18S in animals) and mitochondrial genes.

Ribosomal genes are useful for tracing evolution and relationships, especially in bacteria. However, mitochondrial genes have an advantage over the ribosomal genes as they are not encoded by the nuclear DNA, but are present as circular molecules in the cells. As such they are less likely to be degraded with time. This is advantageous for the forensic scientist, since genetic identification may be possible using bones, teeth, or tissue fragments even when death occurred a long time before.

The presence of unique DNA sequences allows forensic scientists to identify signature sequences that can be later used as probes to detect individual organisms or to detect a particular gene. Changes of even one base pair can be readily detected by most hybridization techniques and by sequencing .

Signature sequences are particularly important for diagnosis of viruses, which are the pathogens that lack ribosomal or mitochondrial genes. Their detection and identification is greatly simplified by using these sequences, as traditional methods can take up to a few weeks.

The unique DNA sequences can also be used to design primers (short DNA fragments needed to initiate DNA amplification) for polymerase chain reaction (PCR ). There are sufficient differences between all the genes within one organism, as well as between organisms from different species, to ensure that the selected primers will only amplify the target sequence even if a mixture of different DNA molecules is present. This allows forensic scientists to design diagnostic and identification tests for the common pathogens and diseases and for parts of pathogen's genome.

Although everyone except for identical twins has unique DNA, the identification of an individual is not based on the sequencing of the individual's genome. Instead, analysis of mitochondrial DNA in a region of a displacement-loop (D-loop or control region) or of short tandem repeats (STRs) is used for identification purposes.

D-loop analysis is used for individual identification in forensic analysis. This is possible due to the polymorphisms of such sequences resulting from substitutions of base pairs during DNA replication process (for example, instead of A, DNA polymerase incorporates T).

The D-loop region is 1274 base pairs long and is located between the genes encoding transfer RNA (tRNA) for proline and tRNA for phenylalanine. It contains the regulatory regions of the for replication other genes.

The main method used for the identification of the changes in this region is PCR amplification and sequencing. However, new microarray approaches that analyze patterns of gene expression in miniature environments such as glass slides or silicon wafers are also being developed.

see also Biodetectors; DNA profiling; RFLP (restriction fragment length polymorphism); STR (short tandem repeat) analysis.

DNA fingerprinting

views updated May 18 2018

DNA fingerprinting also known as DNA typing or genetic fingerprinting, is a method for identifying individuals by the particular structure of their DNA. It gained its name because the structure of the DNA of each person is different, and hence, just as each of us is unique with respect to the pattern of our fingerprints, so we can be identified from our DNA.

As well as containing the 100 000 or so genes that encode the structure of the thousands of proteins from which human beings are constructed, there are large regions of our DNA that do not consist of genes and appear to serve no useful purpose. Part of this functionless, ‘junk’ DNA is made up of long stretches of repeated sequences of the four nucleotide building blocks from which DNA is constructed. There is, however, some order in these repeats. For example, they may form what are called hypervariable regions, also known as mini-satellite DNA, which consist of blocks of tandem repeats of a short ‘core’ sequence. Nearly 100 of these hypervariable regions have been found in the human genome, many but not all of which are close to genes that encode different proteins. The number of copies in these different families of repeats varies widely between unrelated people and thus constitutes a unique genetic profile, or fingerprint. They are of particular value because they are apparently dispersed randomly throughout the genome and therefore are inherited independently of each other.

To produce a DNA fingerprint, DNA from a cell sample is digested with enzymes that cut it up into many different sized pieces and the mixture is placed in a gel. This is then exposed to an electric field and the fragments migrate to different positions by virtue of their size. In this way a pattern is obtained that reflects different numbers of repeats in different individuals; the length of a particular DNA fragment is a function of the number of repeats present.

After the separation of the fragments is complete, the DNA is transferred to a nitrocellulose filter, on which it is immobilized. The position of the fragments containing the repeats is identified by the use of a radioactively labelled DNA probe designed to bind to the core repeat sequences. The fingerprint is visualized by placing an X-ray plate over the filter and developing the film. Since mini-satellite DNA has a relatively high mutation rate, and this varies between different hypervariable regions, in practice it is important to ensure that the rates of mutation of the mini-satellites used for testing are not too great, so as to avoid false exclusions.

DNA fingerprinting is used for many purposes, particularly paternity testing and for forensic work. Of particular concern to the criminal fraternity is that DNA for fingerprinting can be obtained from whole blood, semen, vaginal fluid, hair roots, almost any tissue, and even from bones that have been buried for a long time. The probability that two unrelated individuals show exactly the same pattern varies depending on the particular hypervariable regions that are chosen. In one commonly used system the region analysed yields up to 36 different sized DNA bands, or alleles, for each individual. A band-sharing statistic is estimated at 0.25; that is, the probability of two unrelated individuals sharing the same pattern is 0.253636 or one in 5000 billion billion!

Because of its extreme sensitivity, and because appropriate hypervariable regions can be amplified from minute traces of DNA to produce diagnostic patterns, this technique has revolutionized forensic medicine over recent years.

D. J. Weatherall

Bibliography

Gill, P. (1994). DNA typing. In The enclycopaedia of molecular biology, pp. 286–8. Blackwell Science, Oxford.
Jeffreys, A. J. et al. (1986). DNA fingerprinting and segregation analysis of multiple markers in human pedigrees. American Journal of Human Genetics, 39, 11–24.


See also genetics, human.

DNA Footprinting

views updated Jun 11 2018

DNA Footprinting

DNA footprinting is a technique for identifying exactly where a protein binds to DNA. Knowing where a protein binds to DNA often aids in understanding how gene expression is regulated. Consequently, DNA footprinting is often part of a larger study to determine how a particular gene is controlled.

How It Works

DNA footprinting is based on the observation that when a protein binds to DNA, the DNA is protected from chemicals that would otherwise cleave it. In a typical DNA footprinting experiment, a DNA fragment with a suspected protein-binding site is first isolated, then labeled with a radioactive nucleotide or other chemical that will allow it to be detected later on.

Once labeled, the DNA is then mixed in a test tube with a DNA-binding protein and a chemical that cleaves DNA, such as the enzyme DNase I. In a separate test tube, more of the same labeled DNA is mixed with the same cleaving chemical, but without the binding protein. The DNA fragments in each tube are allowed to incubate long enough for the molecule to cleave once, and then are separated by size (fractionated) in a DNA sequencing gel.

The reactions in the two test tubes (one with the binding protein and one without) are then compared. If the DNA actually contains protein-binding sites, these will have been protected from cleaving in the test tube that contains DNA-binding protein, and a "footprint" of those sites where no DNA cleavage occurred will be observed. By comparison with a sequencing reaction run on the same gel, one can determine the exact location where a protein has been bound to the DNA. A related technique, called gel retardation, can also be used to test for protein binding to DNA, but this method is less precise than DNA footprinting.

Uses in Research

DNA footprinting is often used to locate the binding site for proteins that regulate transcription . For example, a researcher may suspect that a particular protein binds to a particular DNA fragment and inhibits transcription. After conducting a DNA footprinting experiment, the researcher will know the location of the exact sequence of DNA bound by that protein. If that sequence matches the sequence of a promoter the DNA footprinting experiment can help explain how that DNA-binding protein carries out its function.

Modified DNA footprinting experiments can also be performed to detect where proteins bind to DNA in a living cell. In these experiments, cells are grown under conditions where the protein of interest would be expected to bind to DNA. The cells are then treated with a chemical that causes proteins bound to DNA to become permanently attached to the DNA. The resulting DNA-protein complexes are then purified from the cell, and the DNA sequences are identified.

Since DNA footprinting is used to identify the specific sequences in DNA where a protein binds, the technique is likely to be of continuing usefulness in genetic research. For example, DNA footprinting is likely to be heavily used in characterizing the function of proteins identified in the Human Genome Project and other genome projects, making it an important component of a molecular geneticist's toolbox.

see also Gene Expression: Overview of Control; Nucleases; Sequencing DNA.

Patrick G. Guilfoile

Bibliography

Guilfoile, Patrick. A Photographic Atlas for the Molecular Biology Laboratory. Englewood, CO: Morton Publishing, 2000.

Internet Resource

DNA Footprinting Reveals the Sites Where Proteins Bind on a DNA Molecule. National Center for Biotechnology Information. <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Books>.

More From encyclopedia.com